pzt c13 l1 jizhong zou addgene (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
pzt c13 l1 jizhong zou addgene
Pzt C13 L1 Jizhong Zou Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/jizhong+zou/pZT-C13-R1+(Plasmid+%2362197)/pm41610849-345-215-218
Average 94 stars, based on 32 article reviews
Pzt C13 L1 Jizhong Zou Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/jizhong+zou/pZT-C13-R1+(Plasmid+%2362197)/pm41610849-345-215-218
Average 94 stars, based on 32 article reviews
pzt c13 l1 jizhong zou addgene - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Synthesized:Article Title: High-throughput screening for small-molecule stabilizers of misfolded glucocerebrosidase in Gaucher disease and Parkinson’s disease Article Snippet: .. The gRNA targeting LIMP-2 (acagttgacgaattgctctg) was synthesized by Integrated DNA Technologies and cloned into pCAG-eCas9-GFP-U6-gRNA, an all-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9, to generate pCAG-eCas9-GFP-U6-LIMP2_gRNA. pCAG-eCas9GFP-U6-gRNA was a gift from Clone Assay:Article Title: High-throughput screening for small-molecule stabilizers of misfolded glucocerebrosidase in Gaucher disease and Parkinson’s disease Article Snippet: .. The gRNA targeting LIMP-2 (acagttgacgaattgctctg) was synthesized by Integrated DNA Technologies and cloned into pCAG-eCas9-GFP-U6-gRNA, an all-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9, to generate pCAG-eCas9-GFP-U6-LIMP2_gRNA. pCAG-eCas9GFP-U6-gRNA was a gift from Article Title: Combining light-induced aggregation and biotin proximity labeling implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: The donor plasmid pC13N-iCAG.copGFP was a gift from Jizhong Zou (Addgene, Cat. 66578). .. Using this plasmid, we cloned in LIPA-α-syn to create the iCAG-LIPA-α-syn transgene, flanked by homology arms corresponding to the CLYBL locus, this plasmid was co-transfected with TALEN constructs: pZT-C13-L1, and pZT-C13-R1, these plasmids were a gift from Article Title: Combining light-induced aggregation and biotin proximity labeling strongly implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: The donor plasmid pC13N-iCAG.copGFP was a gift from Jizhong Zou (Addgene, Cat. 66578)108. .. Using this plasmid, we cloned in LIPA-α-syn to create the iCAG-LIPA-α-syn transgene, flanked by homology arms corresponding to the CLYBL locus, this plasmid was co-transfected with TALEN constructs: pZTC13-L1, and pZT-C13-R1, these plasmids were a gift from CRISPR:Article Title: High-throughput screening for small-molecule stabilizers of misfolded glucocerebrosidase in Gaucher disease and Parkinson’s disease Article Snippet: .. The gRNA targeting LIMP-2 (acagttgacgaattgctctg) was synthesized by Integrated DNA Technologies and cloned into pCAG-eCas9-GFP-U6-gRNA, an all-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9, to generate pCAG-eCas9-GFP-U6-LIMP2_gRNA. pCAG-eCas9GFP-U6-gRNA was a gift from Plasmid Preparation:Article Title: High-throughput screening for small-molecule stabilizers of misfolded glucocerebrosidase in Gaucher disease and Parkinson’s disease Article Snippet: .. The gRNA targeting LIMP-2 (acagttgacgaattgctctg) was synthesized by Integrated DNA Technologies and cloned into pCAG-eCas9-GFP-U6-gRNA, an all-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9, to generate pCAG-eCas9-GFP-U6-LIMP2_gRNA. pCAG-eCas9GFP-U6-gRNA was a gift from Article Title: Combining light-induced aggregation and biotin proximity labeling strongly implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: .. The donor plasmid pC13N-iCAG.copGFP was a gift from Article Title: Efficient in vivo labeling of endogenous proteins with SMART delineates retina cellular and synaptic organization Article Snippet: The pCAG-GFP plasmid was a gift from Connie Cepko (Addgene plasmid # 11150) . .. The pCAG-eCas9-GFP-U6-gRNA was a gift from Article Title: Combining light-induced aggregation and biotin proximity labeling implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: .. The donor plasmid pC13N-iCAG.copGFP was a gift from Article Title: Efficient in vivo labeling of endogenous proteins with SMART delineates retina cellular and synaptic organization. Article Snippet: The pCAG-GFP plasmid was a gift from Connie Cepko (Addgene plasmid # 11150)14. .. The pCAG-eCas9-GFP-U6-gRNA was a gift from Article Title: Combining light-induced aggregation and biotin proximity labeling implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: The donor plasmid pC13N-iCAG.copGFP was a gift from Jizhong Zou (Addgene, Cat. 66578). .. Using this plasmid, we cloned in LIPA-α-syn to create the iCAG-LIPA-α-syn transgene, flanked by homology arms corresponding to the CLYBL locus, this plasmid was co-transfected with TALEN constructs: pZT-C13-L1, and pZT-C13-R1, these plasmids were a gift from Article Title: Combining light-induced aggregation and biotin proximity labeling strongly implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: The donor plasmid pC13N-iCAG.copGFP was a gift from Jizhong Zou (Addgene, Cat. 66578)108. .. Using this plasmid, we cloned in LIPA-α-syn to create the iCAG-LIPA-α-syn transgene, flanked by homology arms corresponding to the CLYBL locus, this plasmid was co-transfected with TALEN constructs: pZTC13-L1, and pZT-C13-R1, these plasmids were a gift from Article Title: Regulation potential of transcribed simple repeated sequences in developing neurons. Article Snippet: Tissue culture (TC) plates used for culturing iPSCs (typically Thermo Fisher Scientific cat# 140675) were coated by incubating them with 1 μg/cm2 of vitronectin (Thermo Fisher Scientific, cat# A14700) at room temperature for 1 h. For normal passaging, iPSC colonies were incubated with 0.5 mM EDTA (Thermo Fisher Scientific, cat# 15575020) in DPBS (no calcium, no magnesium; Thermo Fisher Scientific, cat# 14190094) at room temperature for 4–8 min and then gently dissociated by trituration in the growth medium. .. The pZT-C13-L1 and pZT-C13-R1 constructs encoding the left and right TALENs specific to the CLYBL safe-harbor locus were a gift from Transfection:Article Title: High-throughput screening for small-molecule stabilizers of misfolded glucocerebrosidase in Gaucher disease and Parkinson’s disease Article Snippet: .. The gRNA targeting LIMP-2 (acagttgacgaattgctctg) was synthesized by Integrated DNA Technologies and cloned into pCAG-eCas9-GFP-U6-gRNA, an all-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9, to generate pCAG-eCas9-GFP-U6-LIMP2_gRNA. pCAG-eCas9GFP-U6-gRNA was a gift from Construct:Article Title: Combining light-induced aggregation and biotin proximity labeling implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: The donor plasmid pC13N-iCAG.copGFP was a gift from Jizhong Zou (Addgene, Cat. 66578). .. Using this plasmid, we cloned in LIPA-α-syn to create the iCAG-LIPA-α-syn transgene, flanked by homology arms corresponding to the CLYBL locus, this plasmid was co-transfected with TALEN constructs: pZT-C13-L1, and pZT-C13-R1, these plasmids were a gift from Article Title: Combining light-induced aggregation and biotin proximity labeling strongly implicates endolysosomal proteins in early α-synuclein oligomerization Article Snippet: The donor plasmid pC13N-iCAG.copGFP was a gift from Jizhong Zou (Addgene, Cat. 66578)108. .. Using this plasmid, we cloned in LIPA-α-syn to create the iCAG-LIPA-α-syn transgene, flanked by homology arms corresponding to the CLYBL locus, this plasmid was co-transfected with TALEN constructs: pZTC13-L1, and pZT-C13-R1, these plasmids were a gift from Article Title: Regulation potential of transcribed simple repeated sequences in developing neurons. Article Snippet: Tissue culture (TC) plates used for culturing iPSCs (typically Thermo Fisher Scientific cat# 140675) were coated by incubating them with 1 μg/cm2 of vitronectin (Thermo Fisher Scientific, cat# A14700) at room temperature for 1 h. For normal passaging, iPSC colonies were incubated with 0.5 mM EDTA (Thermo Fisher Scientific, cat# 15575020) in DPBS (no calcium, no magnesium; Thermo Fisher Scientific, cat# 14190094) at room temperature for 4–8 min and then gently dissociated by trituration in the growth medium. .. The pZT-C13-L1 and pZT-C13-R1 constructs encoding the left and right TALENs specific to the CLYBL safe-harbor locus were a gift from TALENs:Article Title: Regulation potential of transcribed simple repeated sequences in developing neurons. Article Snippet: Tissue culture (TC) plates used for culturing iPSCs (typically Thermo Fisher Scientific cat# 140675) were coated by incubating them with 1 μg/cm2 of vitronectin (Thermo Fisher Scientific, cat# A14700) at room temperature for 1 h. For normal passaging, iPSC colonies were incubated with 0.5 mM EDTA (Thermo Fisher Scientific, cat# 15575020) in DPBS (no calcium, no magnesium; Thermo Fisher Scientific, cat# 14190094) at room temperature for 4–8 min and then gently dissociated by trituration in the growth medium. .. The pZT-C13-L1 and pZT-C13-R1 constructs encoding the left and right TALENs specific to the CLYBL safe-harbor locus were a gift from |